Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44330309036(97.8594%)
Q30 bases: 42708647498(94.2796%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44288365519(97.7668%)
Q30 bases: 42269524432(93.3102%)

Read1 after filtering:
total reads: 294875022
total bases: 37302930763
Q20 bases: 37109893660(99.4825%)
Q30 bases: 36291036957(97.2874%)

Read2 after filtering:
total reads: 294875022
total bases: 37348802207
Q20 bases: 37040590030(99.1748%)
Q30 bases: 36009875968(96.4151%)

Filtering result:
reads passed filter: 589750044
reads failed due to low quality: 8344772
reads failed due to too many N: 191748
reads failed due to too short: 1713436
reads with adapter trimmed: 362919022
bases trimmed due to adapters: 14564494059

Duplication rate: 25.6357%

Insert size peak (evaluated by paired-end reads): 118

JSON report: SW780_FFPE_RNA_0001_B23LG7FLT4_1.fastp.json
HTML report: SW780_FFPE_RNA_0001_B23LG7FLT4_1.fastp.html

fastp --in1 SW780_FFPE_RNA_0001_B23LG7FLT4_1_1.fastq.gz --in2 SW780_FFPE_RNA_0001_B23LG7FLT4_1_2.fastq.gz --out1 SW780_FFPE_RNA_0001_B23LG7FLT4_1_1.fastp.fastq.gz --out2 SW780_FFPE_RNA_0001_B23LG7FLT4_1_2.fastp.fastq.gz --json SW780_FFPE_RNA_0001_B23LG7FLT4_1.fastp.json --html SW780_FFPE_RNA_0001_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 810 seconds