Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 874575
total bases: 132060825
Q20 bases: 122880494(93.0484%)
Q30 bases: 105032897(79.5337%)

Read2 before filtering:
total reads: 874575
total bases: 132060825
Q20 bases: 113467941(85.921%)
Q30 bases: 77415985(58.6215%)

Read1 after filtering:
total reads: 45983
total bases: 2684648
Q20 bases: 2592932(96.5837%)
Q30 bases: 2400520(89.4166%)

Read2 after filtering:
total reads: 45983
total bases: 2768523
Q20 bases: 2667128(96.3376%)
Q30 bases: 2436900(88.0217%)

Filtering result:
reads passed filter: 91966
reads failed due to low quality: 137382
reads failed due to too many N: 38
reads failed due to too short: 1519764
reads with adapter trimmed: 905512
bases trimmed due to adapters: 129998903

Duplication rate: 53.3761%

Insert size peak (evaluated by paired-end reads): 31

JSON report: NTC_0001_0001_B23LG7FLT4_1.fastp.json
HTML report: NTC_0001_0001_B23LG7FLT4_1.fastp.html

fastp --in1 NTC_0001_0001_B23LG7FLT4_1_1.fastq.gz --in2 NTC_0001_0001_B23LG7FLT4_1_2.fastq.gz --out1 NTC_0001_0001_B23LG7FLT4_1_1.fastp.fastq.gz --out2 NTC_0001_0001_B23LG7FLT4_1_2.fastp.fastq.gz --json NTC_0001_0001_B23LG7FLT4_1.fastp.json --html NTC_0001_0001_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 5 seconds