File Info

Filename
A673_FFPE_RNA_0001_B23LG7FLT4_2.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0011/B23LG7FLT4/nfcore_rnafusion__2cae617--20260515-145204/fastp/A673_FFPE_RNA_0001_B23LG7FLT4_2.fastp.log
Size
1.6 KB
Published
May 16, 2026 1:46 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44259298222(97.7026%)
Q30 bases: 42519439323(93.8619%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44240653956(97.6615%)
Q30 bases: 42091964156(92.9182%)

Read1 after filtering:
total reads: 295029063
total bases: 36700932428
Q20 bases: 36508863058(99.4767%)
Q30 bases: 35672388448(97.1975%)

Read2 after filtering:
total reads: 295029063
total bases: 36752306766
Q20 bases: 36433373202(99.1322%)
Q30 bases: 35362661608(96.2189%)

Filtering result:
reads passed filter: 590058126
reads failed due to low quality: 8162650
reads failed due to too many N: 178412
reads failed due to too short: 1600812
reads with adapter trimmed: 378269140
bases trimmed due to adapters: 15815543524

Duplication rate: 24.5959%

Insert size peak (evaluated by paired-end reads): 109

JSON report: A673_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json
HTML report: A673_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html

fastp --in1 A673_FFPE_RNA_0001_B23LG7FLT4_2_1.fastq.gz --in2 A673_FFPE_RNA_0001_B23LG7FLT4_2_2.fastq.gz --out1 A673_FFPE_RNA_0001_B23LG7FLT4_2_1.fastp.fastq.gz --out2 A673_FFPE_RNA_0001_B23LG7FLT4_2_2.fastp.fastq.gz --json A673_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json --html A673_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 730 seconds