Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44640983123(98.5452%)
Q30 bases: 43115628851(95.178%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44265387972(97.7161%)
Q30 bases: 42194153248(93.1438%)

Read1 after filtering:
total reads: 294599174
total bases: 37282123739
Q20 bases: 37095416456(99.4992%)
Q30 bases: 36306636862(97.3835%)

Read2 after filtering:
total reads: 294599174
total bases: 37331456486
Q20 bases: 36991878779(99.0904%)
Q30 bases: 35897831446(96.1597%)

Filtering result:
reads passed filter: 589198348
reads failed due to low quality: 8565622
reads failed due to too many N: 391596
reads failed due to too short: 1844434
reads with adapter trimmed: 358060419
bases trimmed due to adapters: 14525224482

Duplication rate: 24.893%

Insert size peak (evaluated by paired-end reads): 118

JSON report: RT4_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json
HTML report: RT4_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html

fastp --in1 RT4_FFPE_RNA_0001_B23LG7FLT4_3_1.fastq.gz --in2 RT4_FFPE_RNA_0001_B23LG7FLT4_3_2.fastq.gz --out1 RT4_FFPE_RNA_0001_B23LG7FLT4_3_1.fastp.fastq.gz --out2 RT4_FFPE_RNA_0001_B23LG7FLT4_3_2.fastp.fastq.gz --json RT4_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json --html RT4_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 747 seconds