Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44418767220(98.0547%)
Q30 bases: 42841241368(94.5723%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44335739228(97.8714%)
Q30 bases: 42413923089(93.629%)

Read1 after filtering:
total reads: 294906171
total bases: 37886718631
Q20 bases: 37687504854(99.4742%)
Q30 bases: 36837099089(97.2296%)

Read2 after filtering:
total reads: 294906171
total bases: 37929402813
Q20 bases: 37620083647(99.1845%)
Q30 bases: 36576628332(96.4334%)

Filtering result:
reads passed filter: 589812342
reads failed due to low quality: 8316116
reads failed due to too many N: 192246
reads failed due to too short: 1679296
reads with adapter trimmed: 344644291
bases trimmed due to adapters: 13396003042

Duplication rate: 25.376%

Insert size peak (evaluated by paired-end reads): 118

JSON report: RT4_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json
HTML report: RT4_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html

fastp --in1 RT4_FFPE_RNA_0001_B23LG7FLT4_2_1.fastq.gz --in2 RT4_FFPE_RNA_0001_B23LG7FLT4_2_2.fastq.gz --out1 RT4_FFPE_RNA_0001_B23LG7FLT4_2_1.fastp.fastq.gz --out2 RT4_FFPE_RNA_0001_B23LG7FLT4_2_2.fastp.fastq.gz --json RT4_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json --html RT4_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 751 seconds