Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44381926180(97.9733%)
Q30 bases: 42765271652(94.4046%)
Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44340325528(97.8815%)
Q30 bases: 42370004361(93.532%)
Read1 after filtering:
total reads: 295038818
total bases: 37836632130
Q20 bases: 37630188732(99.4544%)
Q30 bases: 36761871618(97.1595%)
Read2 after filtering:
total reads: 295038818
total bases: 37877455196
Q20 bases: 37555916755(99.1511%)
Q30 bases: 36474486712(96.296%)
Filtering result:
reads passed filter: 590077636
reads failed due to low quality: 8263196
reads failed due to too many N: 198536
reads failed due to too short: 1460632
reads with adapter trimmed: 342512622
bases trimmed due to adapters: 13538610758
Duplication rate: 24.5412%
Insert size peak (evaluated by paired-end reads): 119
JSON report: MCF7_FFPE_RNA_0001_B23LG7FLT4_1.fastp.json
HTML report: MCF7_FFPE_RNA_0001_B23LG7FLT4_1.fastp.html
fastp --in1 MCF7_FFPE_RNA_0001_B23LG7FLT4_1_1.fastq.gz --in2 MCF7_FFPE_RNA_0001_B23LG7FLT4_1_2.fastq.gz --out1 MCF7_FFPE_RNA_0001_B23LG7FLT4_1_1.fastp.fastq.gz --out2 MCF7_FFPE_RNA_0001_B23LG7FLT4_1_2.fastp.fastq.gz --json MCF7_FFPE_RNA_0001_B23LG7FLT4_1.fastp.json --html MCF7_FFPE_RNA_0001_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 767 seconds