Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44588286337(98.4289%)
Q30 bases: 43006356266(94.9368%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44310804178(97.8163%)
Q30 bases: 42346391496(93.4799%)

Read1 after filtering:
total reads: 294839900
total bases: 37846216131
Q20 bases: 37638468623(99.4511%)
Q30 bases: 36769163614(97.1541%)

Read2 after filtering:
total reads: 294839900
total bases: 37889036184
Q20 bases: 37577484823(99.1777%)
Q30 bases: 36536368299(96.4299%)

Filtering result:
reads passed filter: 589679800
reads failed due to low quality: 8511272
reads failed due to too many N: 192158
reads failed due to too short: 1616770
reads with adapter trimmed: 345749635
bases trimmed due to adapters: 13459148908

Duplication rate: 25.8708%

Insert size peak (evaluated by paired-end reads): 118

JSON report: RT4_FFPE_RNA_0001_B23LG7FLT4_1.fastp.json
HTML report: RT4_FFPE_RNA_0001_B23LG7FLT4_1.fastp.html

fastp --in1 RT4_FFPE_RNA_0001_B23LG7FLT4_1_1.fastq.gz --in2 RT4_FFPE_RNA_0001_B23LG7FLT4_1_2.fastq.gz --out1 RT4_FFPE_RNA_0001_B23LG7FLT4_1_1.fastp.fastq.gz --out2 RT4_FFPE_RNA_0001_B23LG7FLT4_1_2.fastp.fastq.gz --json RT4_FFPE_RNA_0001_B23LG7FLT4_1.fastp.json --html RT4_FFPE_RNA_0001_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 756 seconds