File Info

Filename
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0011/B23LG7FLT4/nfcore_rnafusion__2cae617--20260515-145204/fastp/OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2.fastp.log
Size
1.6 KB
Published
May 16, 2026 1:54 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 195770788
total bases: 29561388988
Q20 bases: 27812035114(94.0823%)
Q30 bases: 25349002972(85.7504%)

Read2 before filtering:
total reads: 195770788
total bases: 29561388988
Q20 bases: 28408323047(96.0994%)
Q30 bases: 26284310799(88.9143%)

Read1 after filtering:
total reads: 183840906
total bases: 17621670960
Q20 bases: 17504859101(99.3371%)
Q30 bases: 17064002114(96.8353%)

Read2 after filtering:
total reads: 183840906
total bases: 17742897953
Q20 bases: 17537150075(98.8404%)
Q30 bases: 16968927885(95.6379%)

Filtering result:
reads passed filter: 367681812
reads failed due to low quality: 7677000
reads failed due to too many N: 87382
reads failed due to too short: 16095382
reads with adapter trimmed: 351263496
bases trimmed due to adapters: 20672209989

Duplication rate: 40.7419%

Insert size peak (evaluated by paired-end reads): 95

JSON report: OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2.fastp.json
HTML report: OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2.fastp.html

fastp --in1 OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2_1.fastq.gz --in2 OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2_2.fastq.gz --out1 OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2_1.fastp.fastq.gz --out2 OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2_2.fastp.fastq.gz --json OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2.fastp.json --html OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 388 seconds