Detecting adapter sequence for read1...
No adapter detected for read1
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 1173175
total bases: 177149425
Q20 bases: 156688852(88.4501%)
Q30 bases: 122129419(68.9415%)
Read2 before filtering:
total reads: 1173175
total bases: 177149425
Q20 bases: 173127543(97.7297%)
Q30 bases: 150178104(84.7748%)
Read1 after filtering:
total reads: 1147200
total bases: 171561462
Q20 bases: 152970556(89.1637%)
Q30 bases: 120230391(70.0801%)
Read2 after filtering:
total reads: 1147200
total bases: 170211313
Q20 bases: 167552817(98.4381%)
Q30 bases: 146073328(85.8188%)
Filtering result:
reads passed filter: 2294400
reads failed due to low quality: 49254
reads failed due to too many N: 824
reads failed due to too short: 1872
reads with adapter trimmed: 52874
bases trimmed due to adapters: 4865046
Duplication rate: 78.2173%
Insert size peak (evaluated by paired-end reads): 32
JSON report: NTC_0001_0001_B23LG7FLT4_2.fastp.json
HTML report: NTC_0001_0001_B23LG7FLT4_2.fastp.html
fastp --in1 NTC_0001_0001_B23LG7FLT4_2_1.fastq.gz --in2 NTC_0001_0001_B23LG7FLT4_2_2.fastq.gz --out1 NTC_0001_0001_B23LG7FLT4_2_1.fastp.fastq.gz --out2 NTC_0001_0001_B23LG7FLT4_2_2.fastp.fastq.gz --json NTC_0001_0001_B23LG7FLT4_2.fastp.json --html NTC_0001_0001_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe
fastp v0.23.4, time used: 15 seconds