Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 4457634
total bases: 673102734
Q20 bases: 637691797(94.7391%)
Q30 bases: 587569925(87.2928%)

Read2 before filtering:
total reads: 4457634
total bases: 673102734
Q20 bases: 655214748(97.3425%)
Q30 bases: 620187937(92.1387%)

Read1 after filtering:
total reads: 4362646
total bases: 404453033
Q20 bases: 402775533(99.5852%)
Q30 bases: 394747520(97.6003%)

Read2 after filtering:
total reads: 4362646
total bases: 406418144
Q20 bases: 403841536(99.366%)
Q30 bases: 394725698(97.1231%)

Filtering result:
reads passed filter: 8725292
reads failed due to low quality: 143074
reads failed due to too many N: 1390
reads failed due to too short: 45512
reads with adapter trimmed: 8451856
bases trimmed due to adapters: 512351889

Duplication rate: 10.7748%

Insert size peak (evaluated by paired-end reads): 86

JSON report: 1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1.fastp.json
HTML report: 1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1.fastp.html

fastp --in1 1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1_1.fastq.gz --in2 1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1_2.fastq.gz --out1 1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1_1.fastp.fastq.gz --out2 1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1_2.fastp.fastq.gz --json 1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1.fastp.json --html 1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 13 seconds