Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 30429186
total bases: 4594807086
Q20 bases: 4436453530(96.5536%)
Q30 bases: 4194451948(91.2868%)
Read2 before filtering:
total reads: 30429186
total bases: 4594807086
Q20 bases: 4463594163(97.1443%)
Q30 bases: 4211992843(91.6685%)
Read1 after filtering:
total reads: 29706015
total bases: 3243555507
Q20 bases: 3227942002(99.5186%)
Q30 bases: 3160168473(97.4291%)
Read2 after filtering:
total reads: 29706015
total bases: 3254064563
Q20 bases: 3225788010(99.131%)
Q30 bases: 3137373427(96.414%)
Filtering result:
reads passed filter: 59412030
reads failed due to low quality: 1024758
reads failed due to too many N: 1926
reads failed due to too short: 419658
reads with adapter trimmed: 49718284
bases trimmed due to adapters: 2506898340
Duplication rate: 40.7038%
Insert size peak (evaluated by paired-end reads): 95
JSON report: aih-tih-sc-0754d2-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-0754d2-R1_A23YTGFLT4_1.fastp.html
fastp --in1 aih-tih-sc-0754d2-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-0754d2-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-0754d2-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-0754d2-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-0754d2-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-0754d2-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 54 seconds