Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 29323962
total bases: 4427918262
Q20 bases: 4247853633(95.9334%)
Q30 bases: 4004976624(90.4483%)

Read2 before filtering:
total reads: 29323962
total bases: 4427918262
Q20 bases: 4312438258(97.392%)
Q30 bases: 4070176037(91.9208%)

Read1 after filtering:
total reads: 28784902
total bases: 2999306443
Q20 bases: 2985393009(99.5361%)
Q30 bases: 2923195078(97.4624%)

Read2 after filtering:
total reads: 28784902
total bases: 3004301796
Q20 bases: 2985597594(99.3774%)
Q30 bases: 2917281593(97.1035%)

Filtering result:
reads passed filter: 57569804
reads failed due to low quality: 607852
reads failed due to too many N: 1802
reads failed due to too short: 468466
reads with adapter trimmed: 51772731
bases trimmed due to adapters: 2714891854

Duplication rate: 36.642%

Insert size peak (evaluated by paired-end reads): 96

JSON report: aih-tih-sc-d5fda9-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-d5fda9-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-d5fda9-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-d5fda9-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-d5fda9-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-d5fda9-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-d5fda9-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-d5fda9-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 62 seconds