Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 186338622
total bases: 28137131922
Q20 bases: 27399387338(97.378%)
Q30 bases: 26190297816(93.0809%)

Read2 before filtering:
total reads: 186338622
total bases: 28137131922
Q20 bases: 27481195338(97.6688%)
Q30 bases: 26131942263(92.8735%)

Read1 after filtering:
total reads: 183773725
total bases: 21177459093
Q20 bases: 21086413010(99.5701%)
Q30 bases: 20662193282(97.5669%)

Read2 after filtering:
total reads: 183773725
total bases: 21209883776
Q20 bases: 21062377764(99.3045%)
Q30 bases: 20538078496(96.8326%)

Filtering result:
reads passed filter: 367547450
reads failed due to low quality: 4768698
reads failed due to too many N: 12570
reads failed due to too short: 348526
reads with adapter trimmed: 285981141
bases trimmed due to adapters: 13223376426

Duplication rate: 38.3239%

Insert size peak (evaluated by paired-end reads): 100

JSON report: aih-tih-sc-607ec3-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-607ec3-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-607ec3-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-607ec3-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-607ec3-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-607ec3-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-607ec3-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-607ec3-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 394 seconds