Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 149616053
total bases: 22592024003
Q20 bases: 21892449551(96.9034%)
Q30 bases: 20827871511(92.1913%)

Read2 before filtering:
total reads: 149616053
total bases: 22592024003
Q20 bases: 22101835238(97.8303%)
Q30 bases: 21052701578(93.1864%)

Read1 after filtering:
total reads: 147587887
total bases: 16281367559
Q20 bases: 16212467664(99.5768%)
Q30 bases: 15895479259(97.6299%)

Read2 after filtering:
total reads: 147587887
total bases: 16305711153
Q20 bases: 16204363539(99.3785%)
Q30 bases: 15834317182(97.109%)

Filtering result:
reads passed filter: 295175774
reads failed due to low quality: 3428682
reads failed due to too many N: 9682
reads failed due to too short: 617968
reads with adapter trimmed: 247401165
bases trimmed due to adapters: 12078437388

Duplication rate: 37.3953%

Insert size peak (evaluated by paired-end reads): 97

JSON report: aih-tih-sc-a558c6-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-a558c6-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-a558c6-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-a558c6-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-a558c6-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-a558c6-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-a558c6-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-a558c6-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 283 seconds