Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 195659080
total bases: 29544521080
Q20 bases: 28660730821(97.0086%)
Q30 bases: 27404679392(92.7572%)

Read2 before filtering:
total reads: 195659080
total bases: 29544521080
Q20 bases: 28827292875(97.5724%)
Q30 bases: 27361881973(92.6124%)

Read1 after filtering:
total reads: 192722592
total bases: 22178821289
Q20 bases: 22077207226(99.5418%)
Q30 bases: 21624773463(97.5019%)

Read2 after filtering:
total reads: 192722592
total bases: 22219468464
Q20 bases: 22062554016(99.2938%)
Q30 bases: 21519053331(96.8477%)

Filtering result:
reads passed filter: 385445184
reads failed due to low quality: 4996304
reads failed due to too many N: 13554
reads failed due to too short: 863118
reads with adapter trimmed: 299278430
bases trimmed due to adapters: 13928820404

Duplication rate: 46.2782%

Insert size peak (evaluated by paired-end reads): 98

JSON report: aih-tih-sc-31d31f-R1_A23YTGFLT4_1.fastp.json
HTML report: aih-tih-sc-31d31f-R1_A23YTGFLT4_1.fastp.html

fastp --in1 aih-tih-sc-31d31f-R1_A23YTGFLT4_1_1.fastq.gz --in2 aih-tih-sc-31d31f-R1_A23YTGFLT4_1_2.fastq.gz --out1 aih-tih-sc-31d31f-R1_A23YTGFLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-31d31f-R1_A23YTGFLT4_1_2.fastp.fastq.gz --json aih-tih-sc-31d31f-R1_A23YTGFLT4_1.fastp.json --html aih-tih-sc-31d31f-R1_A23YTGFLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 424 seconds