File Info

Filename
659_cuO-T1-TRNA-1_B23MHV2LT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0009_exp0010/B23MHV2LT4/nfcore_rnafusion__04da504a--20260522-114016/fastp/659_cuO-T1-TRNA-1_B23MHV2LT4_1.fastp.log
Size
1.5 KB
Published
May 22, 2026 12:47 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 192558
total bases: 29076258
Q20 bases: 25289590(86.9768%)
Q30 bases: 19716259(67.8088%)

Read2 before filtering:
total reads: 192558
total bases: 29076258
Q20 bases: 27121292(93.2764%)
Q30 bases: 20571225(70.7492%)

Read1 after filtering:
total reads: 22319
total bases: 1289996
Q20 bases: 1234824(95.7231%)
Q30 bases: 1137792(88.2012%)

Read2 after filtering:
total reads: 22319
total bases: 1338456
Q20 bases: 1290401(96.4097%)
Q30 bases: 1182606(88.356%)

Filtering result:
reads passed filter: 44638
reads failed due to low quality: 20760
reads failed due to too many N: 2
reads failed due to too short: 319716
reads with adapter trimmed: 209635
bases trimmed due to adapters: 9660305

Duplication rate: 53.964%

Insert size peak (evaluated by paired-end reads): 36

JSON report: 659_cuO-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_cuO-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_cuO-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_cuO-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_cuO-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_cuO-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_cuO-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_cuO-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 4 seconds