File Info

Filename
.command.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/cd/3a7be75af9d1b67393ef4af1984905/.command.log
Size
2.0 KB
Attempt
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/cd/3a7be75af9d1b67393ef4af1984905/.command.sh
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/cd/3a7be75af9d1b67393ef4af1984905/.command.run
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/49/5b6669f669910d6d39f6539c0d8499/output/HCC1395_BL_S2_L005_R1_001.fastq.gz
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/49/5b6669f669910d6d39f6539c0d8499/output/HCC1395_BL_S2_L005_R2_001.fastq.gz
==> STAGING COMPLETE (4 inputs)

Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62794
total bases: 9419100
Q20 bases: 9250604(98.2111%)
Q30 bases: 8921224(94.7142%)
Q40 bases: 8921224(94.7142%)

Read2 before filtering:
total reads: 62794
total bases: 9419100
Q20 bases: 9189311(97.5604%)
Q30 bases: 8786919(93.2883%)
Q40 bases: 8786919(93.2883%)

Read1 after filtering:
total reads: 62794
total bases: 9066702
Q20 bases: 8933948(98.5358%)
Q30 bases: 8636084(95.2506%)
Q40 bases: 8636084(95.2506%)

Read2 after filtering:
total reads: 62794
total bases: 9067009
Q20 bases: 8870934(97.8375%)
Q30 bases: 8506004(93.8127%)
Q40 bases: 8506004(93.8127%)

Filtering result:
reads passed filter: 125588
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 19165
bases trimmed due to adapters: 704489

Duplication rate: 0.880657%

Insert size peak (evaluated by paired-end reads): 149

JSON report: HCC1395_BL.fastp.json
HTML report: HCC1395_BL.fastp.html

fastp --in1 HCC1395_BL_S2_L005_R1_001.fastq.gz --in2 HCC1395_BL_S2_L005_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4 
fastp v1.0.1, time used: 1 seconds