Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44393639723(97.9992%)
Q30 bases: 42726471226(94.3189%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44346391912(97.8949%)
Q30 bases: 42368688879(93.5291%)

Read1 after filtering:
total reads: 295131003
total bases: 37649126663
Q20 bases: 37454019542(99.4818%)
Q30 bases: 36629553220(97.2919%)

Read2 after filtering:
total reads: 295131003
total bases: 37690315782
Q20 bases: 37381208795(99.1799%)
Q30 bases: 36344283836(96.4287%)

Filtering result:
reads passed filter: 590262006
reads failed due to low quality: 8020850
reads failed due to too many N: 209352
reads failed due to too short: 1507792
reads with adapter trimmed: 351219202
bases trimmed due to adapters: 13938489238

Duplication rate: 24.8973%

Insert size peak (evaluated by paired-end reads): 119

JSON report: 786-O_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json
HTML report: 786-O_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html

fastp --in1 786-O_FFPE_RNA_0001_B23LG7FLT4_2_1.fastq.gz --in2 786-O_FFPE_RNA_0001_B23LG7FLT4_2_2.fastq.gz --out1 786-O_FFPE_RNA_0001_B23LG7FLT4_2_1.fastp.fastq.gz --out2 786-O_FFPE_RNA_0001_B23LG7FLT4_2_2.fastp.fastq.gz --json 786-O_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json --html 786-O_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 757 seconds