Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44508706955(98.2532%)
Q30 bases: 42930776655(94.7699%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44313687809(97.8227%)
Q30 bases: 42295993589(93.3686%)

Read1 after filtering:
total reads: 295167076
total bases: 37642078406
Q20 bases: 37447184259(99.4822%)
Q30 bases: 36617868051(97.2791%)

Read2 after filtering:
total reads: 295167076
total bases: 37686700426
Q20 bases: 37382859657(99.1938%)
Q30 bases: 36358713640(96.4762%)

Filtering result:
reads passed filter: 590334152
reads failed due to low quality: 8060204
reads failed due to too many N: 193268
reads failed due to too short: 1412376
reads with adapter trimmed: 354160034
bases trimmed due to adapters: 13959202491

Duplication rate: 25.8599%

Insert size peak (evaluated by paired-end reads): 119

JSON report: SW780_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json
HTML report: SW780_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html

fastp --in1 SW780_FFPE_RNA_0001_B23LG7FLT4_2_1.fastq.gz --in2 SW780_FFPE_RNA_0001_B23LG7FLT4_2_2.fastq.gz --out1 SW780_FFPE_RNA_0001_B23LG7FLT4_2_1.fastp.fastq.gz --out2 SW780_FFPE_RNA_0001_B23LG7FLT4_2_2.fastp.fastq.gz --json SW780_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json --html SW780_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 767 seconds